pub struct CurveIter<I: Iterator<Item = u8>> { /* private fields */ }Expand description
An iterator that computes the curvature of a DNA sequence.
CurveIter wraps an iterator that yields u8 and computes the curvature of the DNA sequence
represented by the nucleotides.
§Fields
inner: The inner iterator that yieldsu8.
Implementations§
Source§impl<I: Iterator<Item = u8>> CurveIter<I>
Construct a CurveIter from an iterator that yields u8.
impl<I: Iterator<Item = u8>> CurveIter<I>
Construct a CurveIter from an iterator that yields u8.
This function constructs a CurveIter from an iterator that yields u8. The CurveIter
computes the curvature of the DNA sequence represented by the nucleotides.
§Parameters
seq_iter: An iterator that yieldsu8.roll_type: The type of roll (either simple or activated).step_b: Half of the window size minus one. In other words, 2 *step_size+ 1 is the size of the window.step_c: The distance from the midpoint base to the sides in the curve window.
Sourcepub fn new(
seq_iter: I,
roll_type: RollType,
step_b: usize,
step_c: usize,
curve_scale: f64,
) -> Self
pub fn new( seq_iter: I, roll_type: RollType, step_b: usize, step_c: usize, curve_scale: f64, ) -> Self
Build a curvature iterator over a stream of bases.
Bases must be A, C, G or T in either case; anything else will panic, so split a
record with crate::fasta::split_seq_by_gaps first. For scoring whole records
use crate::curve::scan, which handles splitting, positions and threading.
The first step_b + step_c + 1 bases and the last of the same produce no value,
because the windows need context on both sides.
use symcurve::curve::iters::CurveIter;
use symcurve::curve::matrix::RollType;
let seq = b"CCAACATTTTGACTTTTTGGGAGGGCACTAGCACCTATCTACCCTGAATC";
let curves: Vec<f64> =
CurveIter::new(seq.iter().copied(), RollType::Simple, 5, 15, 0.33335).collect();
assert_eq!(curves.len(), seq.len() - 2 * (5 + 15 + 1));Trait Implementations§
impl<I: Iterator<Item = u8>> FusedIterator for CurveIter<I>
Source§impl<I: Iterator<Item = u8>> Iterator for CurveIter<I>
impl<I: Iterator<Item = u8>> Iterator for CurveIter<I>
Source§fn size_hint(&self) -> (usize, Option<usize>)
fn size_hint(&self) -> (usize, Option<usize>)
Source§fn next_chunk<const N: usize>(
&mut self,
) -> Result<[Self::Item; N], IntoIter<Self::Item, N>>where
Self: Sized,
fn next_chunk<const N: usize>(
&mut self,
) -> Result<[Self::Item; N], IntoIter<Self::Item, N>>where
Self: Sized,
iter_next_chunk)N values. Read more1.0.0 (const: unstable) · Source§fn count(self) -> usizewhere
Self: Sized,
fn count(self) -> usizewhere
Self: Sized,
1.0.0 (const: unstable) · Source§fn last(self) -> Option<Self::Item>where
Self: Sized,
fn last(self) -> Option<Self::Item>where
Self: Sized,
Source§fn advance_by(&mut self, n: usize) -> Result<(), NonZero<usize>>
fn advance_by(&mut self, n: usize) -> Result<(), NonZero<usize>>
iter_advance_by)n elements. Read more1.0.0 (const: unstable) · Source§fn nth(&mut self, n: usize) -> Option<Self::Item>
fn nth(&mut self, n: usize) -> Option<Self::Item>
nth element of the iterator. Read more1.28.0 (const: unstable) · Source§fn step_by(self, step: usize) -> StepBy<Self>where
Self: Sized,
fn step_by(self, step: usize) -> StepBy<Self>where
Self: Sized,
1.0.0 (const: unstable) · Source§fn chain<U>(self, other: U) -> Chain<Self, <U as IntoIterator>::IntoIter>
fn chain<U>(self, other: U) -> Chain<Self, <U as IntoIterator>::IntoIter>
1.0.0 (const: unstable) · Source§fn zip<U>(self, other: U) -> Zip<Self, <U as IntoIterator>::IntoIter>where
Self: Sized,
U: IntoIterator,
fn zip<U>(self, other: U) -> Zip<Self, <U as IntoIterator>::IntoIter>where
Self: Sized,
U: IntoIterator,
Source§fn intersperse(self, separator: Self::Item) -> Intersperse<Self>
fn intersperse(self, separator: Self::Item) -> Intersperse<Self>
iter_intersperse)separator between items
of the original iterator. Read moreSource§fn intersperse_with<G>(self, separator: G) -> IntersperseWith<Self, G>
fn intersperse_with<G>(self, separator: G) -> IntersperseWith<Self, G>
iter_intersperse)separator
between items of the original iterator. Read more1.0.0 (const: unstable) · Source§fn map<B, F>(self, f: F) -> Map<Self, F>
fn map<B, F>(self, f: F) -> Map<Self, F>
1.21.0 (const: unstable) · Source§fn for_each<F>(self, f: F)
fn for_each<F>(self, f: F)
1.0.0 (const: unstable) · Source§fn filter<P>(self, predicate: P) -> Filter<Self, P>
fn filter<P>(self, predicate: P) -> Filter<Self, P>
1.0.0 (const: unstable) · Source§fn filter_map<B, F>(self, f: F) -> FilterMap<Self, F>
fn filter_map<B, F>(self, f: F) -> FilterMap<Self, F>
1.0.0 (const: unstable) · Source§fn enumerate(self) -> Enumerate<Self>where
Self: Sized,
fn enumerate(self) -> Enumerate<Self>where
Self: Sized,
1.0.0 (const: unstable) · Source§fn skip_while<P>(self, predicate: P) -> SkipWhile<Self, P>
fn skip_while<P>(self, predicate: P) -> SkipWhile<Self, P>
1.0.0 (const: unstable) · Source§fn take_while<P>(self, predicate: P) -> TakeWhile<Self, P>
fn take_while<P>(self, predicate: P) -> TakeWhile<Self, P>
1.57.0 (const: unstable) · Source§fn map_while<B, P>(self, predicate: P) -> MapWhile<Self, P>
fn map_while<B, P>(self, predicate: P) -> MapWhile<Self, P>
1.0.0 (const: unstable) · Source§fn skip(self, n: usize) -> Skip<Self>where
Self: Sized,
fn skip(self, n: usize) -> Skip<Self>where
Self: Sized,
n elements. Read more1.0.0 (const: unstable) · Source§fn take(self, n: usize) -> Take<Self>where
Self: Sized,
fn take(self, n: usize) -> Take<Self>where
Self: Sized,
n elements, or fewer
if the underlying iterator ends sooner. Read more1.0.0 (const: unstable) · Source§fn scan<St, B, F>(self, initial_state: St, f: F) -> Scan<Self, St, F>
fn scan<St, B, F>(self, initial_state: St, f: F) -> Scan<Self, St, F>
1.0.0 (const: unstable) · Source§fn flat_map<U, F>(self, f: F) -> FlatMap<Self, U, F>
fn flat_map<U, F>(self, f: F) -> FlatMap<Self, U, F>
1.29.0 (const: unstable) · Source§fn flatten(self) -> Flatten<Self>
fn flatten(self) -> Flatten<Self>
Source§fn map_windows<F, R, const N: usize>(self, f: F) -> MapWindows<Self, F, N>
fn map_windows<F, R, const N: usize>(self, f: F) -> MapWindows<Self, F, N>
iter_map_windows)f for each contiguous window of size N over
self and returns an iterator over the outputs of f. Like slice::windows(),
the windows during mapping overlap as well. Read more1.0.0 (const: unstable) · Source§fn inspect<F>(self, f: F) -> Inspect<Self, F>
fn inspect<F>(self, f: F) -> Inspect<Self, F>
1.0.0 (const: unstable) · Source§fn by_ref(&mut self) -> &mut Selfwhere
Self: Sized,
fn by_ref(&mut self) -> &mut Selfwhere
Self: Sized,
Iterator. Read more1.0.0 (const: unstable) · Source§fn collect<B>(self) -> B
fn collect<B>(self) -> B
Source§fn try_collect<B>(
&mut self,
) -> <<Self::Item as Try>::Residual as Residual<B>>::TryType
fn try_collect<B>( &mut self, ) -> <<Self::Item as Try>::Residual as Residual<B>>::TryType
iterator_try_collect)Source§fn collect_into<E>(self, collection: &mut E) -> &mut E
fn collect_into<E>(self, collection: &mut E) -> &mut E
iter_collect_into)1.0.0 (const: unstable) · Source§fn partition<B, F>(self, f: F) -> (B, B)
fn partition<B, F>(self, f: F) -> (B, B)
Source§fn is_partitioned<P>(self, predicate: P) -> bool
fn is_partitioned<P>(self, predicate: P) -> bool
iter_is_partitioned)true precede all those that return false. Read more1.27.0 (const: unstable) · Source§fn try_fold<B, F, R>(&mut self, init: B, f: F) -> R
fn try_fold<B, F, R>(&mut self, init: B, f: F) -> R
1.27.0 (const: unstable) · Source§fn try_for_each<F, R>(&mut self, f: F) -> R
fn try_for_each<F, R>(&mut self, f: F) -> R
1.0.0 (const: unstable) · Source§fn fold<B, F>(self, init: B, f: F) -> B
fn fold<B, F>(self, init: B, f: F) -> B
1.51.0 (const: unstable) · Source§fn reduce<F>(self, f: F) -> Option<Self::Item>
fn reduce<F>(self, f: F) -> Option<Self::Item>
Source§fn try_reduce<R>(
&mut self,
f: impl FnMut(Self::Item, Self::Item) -> R,
) -> <<R as Try>::Residual as Residual<Option<<R as Try>::Output>>>::TryType
fn try_reduce<R>( &mut self, f: impl FnMut(Self::Item, Self::Item) -> R, ) -> <<R as Try>::Residual as Residual<Option<<R as Try>::Output>>>::TryType
iterator_try_reduce)1.0.0 (const: unstable) · Source§fn all<F>(&mut self, f: F) -> bool
fn all<F>(&mut self, f: F) -> bool
1.0.0 (const: unstable) · Source§fn any<F>(&mut self, f: F) -> bool
fn any<F>(&mut self, f: F) -> bool
1.0.0 (const: unstable) · Source§fn find<P>(&mut self, predicate: P) -> Option<Self::Item>
fn find<P>(&mut self, predicate: P) -> Option<Self::Item>
1.30.0 (const: unstable) · Source§fn find_map<B, F>(&mut self, f: F) -> Option<B>
fn find_map<B, F>(&mut self, f: F) -> Option<B>
Source§fn try_find<R>(
&mut self,
f: impl FnMut(&Self::Item) -> R,
) -> <<R as Try>::Residual as Residual<Option<Self::Item>>>::TryType
fn try_find<R>( &mut self, f: impl FnMut(&Self::Item) -> R, ) -> <<R as Try>::Residual as Residual<Option<Self::Item>>>::TryType
try_find)1.0.0 (const: unstable) · Source§fn position<P>(&mut self, predicate: P) -> Option<usize>
fn position<P>(&mut self, predicate: P) -> Option<usize>
1.0.0 (const: unstable) · Source§fn max(self) -> Option<Self::Item>
fn max(self) -> Option<Self::Item>
1.0.0 (const: unstable) · Source§fn min(self) -> Option<Self::Item>
fn min(self) -> Option<Self::Item>
1.6.0 (const: unstable) · Source§fn max_by_key<B, F>(self, f: F) -> Option<Self::Item>
fn max_by_key<B, F>(self, f: F) -> Option<Self::Item>
1.15.0 (const: unstable) · Source§fn max_by<F>(self, compare: F) -> Option<Self::Item>
fn max_by<F>(self, compare: F) -> Option<Self::Item>
1.6.0 (const: unstable) · Source§fn min_by_key<B, F>(self, f: F) -> Option<Self::Item>
fn min_by_key<B, F>(self, f: F) -> Option<Self::Item>
1.15.0 (const: unstable) · Source§fn min_by<F>(self, compare: F) -> Option<Self::Item>
fn min_by<F>(self, compare: F) -> Option<Self::Item>
1.0.0 (const: unstable) · Source§fn unzip<A, B, FromA, FromB>(self) -> (FromA, FromB)
fn unzip<A, B, FromA, FromB>(self) -> (FromA, FromB)
1.36.0 (const: unstable) · Source§fn copied<'a, T>(self) -> Copied<Self>
fn copied<'a, T>(self) -> Copied<Self>
Source§fn array_chunks<const N: usize>(self) -> ArrayChunks<Self, N>where
Self: Sized,
fn array_chunks<const N: usize>(self) -> ArrayChunks<Self, N>where
Self: Sized,
iter_array_chunks)N elements of the iterator at a time. Read more1.11.0 (const: unstable) · Source§fn product<P>(self) -> P
fn product<P>(self) -> P
Source§fn cmp_by<I, F>(self, other: I, cmp: F) -> Ordering
fn cmp_by<I, F>(self, other: I, cmp: F) -> Ordering
iter_order_by)Iterator with those
of another with respect to the specified comparison function. Read more1.5.0 (const: unstable) · Source§fn partial_cmp<I>(self, other: I) -> Option<Ordering>
fn partial_cmp<I>(self, other: I) -> Option<Ordering>
PartialOrd elements of
this Iterator with those of another. The comparison works like short-circuit
evaluation, returning a result without comparing the remaining elements.
As soon as an order can be determined, the evaluation stops and a result is returned. Read moreSource§fn partial_cmp_by<I, F>(self, other: I, partial_cmp: F) -> Option<Ordering>where
Self: Sized,
I: IntoIterator,
F: FnMut(Self::Item, <I as IntoIterator>::Item) -> Option<Ordering>,
fn partial_cmp_by<I, F>(self, other: I, partial_cmp: F) -> Option<Ordering>where
Self: Sized,
I: IntoIterator,
F: FnMut(Self::Item, <I as IntoIterator>::Item) -> Option<Ordering>,
iter_order_by)Iterator with those
of another with respect to the specified comparison function. Read moreSource§fn eq_by<I, F>(self, other: I, eq: F) -> bool
fn eq_by<I, F>(self, other: I, eq: F) -> bool
iter_order_by)1.5.0 (const: unstable) · Source§fn lt<I>(self, other: I) -> bool
fn lt<I>(self, other: I) -> bool
Iterator are lexicographically
less than those of another. Read more1.5.0 (const: unstable) · Source§fn le<I>(self, other: I) -> bool
fn le<I>(self, other: I) -> bool
Iterator are lexicographically
less or equal to those of another. Read more1.5.0 (const: unstable) · Source§fn gt<I>(self, other: I) -> bool
fn gt<I>(self, other: I) -> bool
Iterator are lexicographically
greater than those of another. Read more1.5.0 (const: unstable) · Source§fn ge<I>(self, other: I) -> bool
fn ge<I>(self, other: I) -> bool
Iterator are lexicographically
greater than or equal to those of another. Read more1.82.0 (const: unstable) · Source§fn is_sorted(self) -> bool
fn is_sorted(self) -> bool
1.82.0 (const: unstable) · Source§fn is_sorted_by<F>(self, compare: F) -> bool
fn is_sorted_by<F>(self, compare: F) -> bool
Auto Trait Implementations§
impl<I> Freeze for CurveIter<I>where
I: Freeze,
impl<I> RefUnwindSafe for CurveIter<I>where
I: RefUnwindSafe,
impl<I> Send for CurveIter<I>where
I: Send,
impl<I> Sync for CurveIter<I>where
I: Sync,
impl<I> Unpin for CurveIter<I>where
I: Unpin,
impl<I> UnsafeUnpin for CurveIter<I>where
I: UnsafeUnpin,
impl<I> UnwindSafe for CurveIter<I>where
I: UnwindSafe,
Blanket Implementations§
Source§impl<T> BorrowMut<T> for Twhere
T: ?Sized,
impl<T> BorrowMut<T> for Twhere
T: ?Sized,
Source§fn borrow_mut(&mut self) -> &mut T
fn borrow_mut(&mut self) -> &mut T
Source§impl<T> IntoEither for T
impl<T> IntoEither for T
Source§fn into_either(self, into_left: bool) -> Either<Self, Self>
fn into_either(self, into_left: bool) -> Either<Self, Self>
self into a Left variant of Either<Self, Self>
if into_left is true.
Converts self into a Right variant of Either<Self, Self>
otherwise. Read moreSource§fn into_either_with<F>(self, into_left: F) -> Either<Self, Self>
fn into_either_with<F>(self, into_left: F) -> Either<Self, Self>
self into a Left variant of Either<Self, Self>
if into_left(&self) returns true.
Converts self into a Right variant of Either<Self, Self>
otherwise. Read moreSource§impl<I> IntoIterator for Iwhere
I: Iterator,
impl<I> IntoIterator for Iwhere
I: Iterator,
Source§impl<T> Itertools for T
impl<T> Itertools for T
Source§fn interleave<J>(
self,
other: J,
) -> Interleave<Self, <J as IntoIterator>::IntoIter>
fn interleave<J>( self, other: J, ) -> Interleave<Self, <J as IntoIterator>::IntoIter>
Source§fn interleave_shortest<J>(
self,
other: J,
) -> InterleaveShortest<Self, <J as IntoIterator>::IntoIter>
fn interleave_shortest<J>( self, other: J, ) -> InterleaveShortest<Self, <J as IntoIterator>::IntoIter>
Source§fn intersperse(
self,
element: Self::Item,
) -> IntersperseWith<Self, IntersperseElementSimple<Self::Item>>
fn intersperse( self, element: Self::Item, ) -> IntersperseWith<Self, IntersperseElementSimple<Self::Item>>
Source§fn intersperse_with<F>(self, element: F) -> IntersperseWith<Self, F>
fn intersperse_with<F>(self, element: F) -> IntersperseWith<Self, F>
Source§fn zip_longest<J>(
self,
other: J,
) -> ZipLongest<Self, <J as IntoIterator>::IntoIter>where
J: IntoIterator,
Self: Sized,
fn zip_longest<J>(
self,
other: J,
) -> ZipLongest<Self, <J as IntoIterator>::IntoIter>where
J: IntoIterator,
Self: Sized,
Source§fn zip_eq<J>(self, other: J) -> ZipEq<Self, <J as IntoIterator>::IntoIter>where
J: IntoIterator,
Self: Sized,
fn zip_eq<J>(self, other: J) -> ZipEq<Self, <J as IntoIterator>::IntoIter>where
J: IntoIterator,
Self: Sized,
Source§fn batching<B, F>(self, f: F) -> Batching<Self, F>
fn batching<B, F>(self, f: F) -> Batching<Self, F>
Source§fn group_by<K, F>(self, key: F) -> GroupBy<K, Self, F>
fn group_by<K, F>(self, key: F) -> GroupBy<K, Self, F>
Source§fn chunks(self, size: usize) -> IntoChunks<Self>where
Self: Sized,
fn chunks(self, size: usize) -> IntoChunks<Self>where
Self: Sized,
Source§fn tuple_windows<T>(self) -> TupleWindows<Self, T>where
Self: Sized + Iterator<Item = <T as TupleCollect>::Item>,
T: HomogeneousTuple,
<T as TupleCollect>::Item: Clone,
fn tuple_windows<T>(self) -> TupleWindows<Self, T>where
Self: Sized + Iterator<Item = <T as TupleCollect>::Item>,
T: HomogeneousTuple,
<T as TupleCollect>::Item: Clone,
Source§fn circular_tuple_windows<T>(self) -> CircularTupleWindows<Self, T>
fn circular_tuple_windows<T>(self) -> CircularTupleWindows<Self, T>
Source§fn tuples<T>(self) -> Tuples<Self, T>
fn tuples<T>(self) -> Tuples<Self, T>
Source§fn tee(self) -> (Tee<Self>, Tee<Self>)
fn tee(self) -> (Tee<Self>, Tee<Self>)
Source§fn step(self, n: usize) -> Step<Self>where
Self: Sized,
fn step(self, n: usize) -> Step<Self>where
Self: Sized,
Use std .step_by() instead
n elements in the base iterator
for each iteration. Read moreSource§fn map_results<F, T, U, E>(
self,
f: F,
) -> MapSpecialCase<Self, MapSpecialCaseFnOk<F>>
fn map_results<F, T, U, E>( self, f: F, ) -> MapSpecialCase<Self, MapSpecialCaseFnOk<F>>
Use .map_ok() instead
.map_ok().Source§fn map_ok<F, T, U, E>(self, f: F) -> MapSpecialCase<Self, MapSpecialCaseFnOk<F>>
fn map_ok<F, T, U, E>(self, f: F) -> MapSpecialCase<Self, MapSpecialCaseFnOk<F>>
Result::Ok value. Result::Err values are
unchanged. Read moreSource§fn filter_ok<F, T, E>(self, f: F) -> FilterOk<Self, F>
fn filter_ok<F, T, E>(self, f: F) -> FilterOk<Self, F>
Result::Ok
value with the provided closure. Result::Err values are
unchanged. Read moreSource§fn filter_map_ok<F, T, U, E>(self, f: F) -> FilterMapOk<Self, F>
fn filter_map_ok<F, T, U, E>(self, f: F) -> FilterMapOk<Self, F>
Result::Ok value with the provided closure. Result::Err
values are unchanged. Read moreSource§fn flatten_ok<T, E>(self) -> FlattenOk<Self, T, E>
fn flatten_ok<T, E>(self) -> FlattenOk<Self, T, E>
Result::Ok value into
a series of Result::Ok values. Result::Err values are unchanged. Read moreSource§fn merge<J>(
self,
other: J,
) -> MergeBy<Self, <J as IntoIterator>::IntoIter, MergeLte>
fn merge<J>( self, other: J, ) -> MergeBy<Self, <J as IntoIterator>::IntoIter, MergeLte>
Source§fn merge_by<J, F>(
self,
other: J,
is_first: F,
) -> MergeBy<Self, <J as IntoIterator>::IntoIter, F>
fn merge_by<J, F>( self, other: J, is_first: F, ) -> MergeBy<Self, <J as IntoIterator>::IntoIter, F>
Source§fn merge_join_by<J, F>(
self,
other: J,
cmp_fn: F,
) -> MergeJoinBy<Self, <J as IntoIterator>::IntoIter, F>
fn merge_join_by<J, F>( self, other: J, cmp_fn: F, ) -> MergeJoinBy<Self, <J as IntoIterator>::IntoIter, F>
Source§fn kmerge(self) -> KMergeBy<<Self::Item as IntoIterator>::IntoIter, KMergeByLt>
fn kmerge(self) -> KMergeBy<<Self::Item as IntoIterator>::IntoIter, KMergeByLt>
Source§fn kmerge_by<F>(
self,
first: F,
) -> KMergeBy<<Self::Item as IntoIterator>::IntoIter, F>where
Self: Sized,
Self::Item: IntoIterator,
F: FnMut(&<Self::Item as IntoIterator>::Item, &<Self::Item as IntoIterator>::Item) -> bool,
fn kmerge_by<F>(
self,
first: F,
) -> KMergeBy<<Self::Item as IntoIterator>::IntoIter, F>where
Self: Sized,
Self::Item: IntoIterator,
F: FnMut(&<Self::Item as IntoIterator>::Item, &<Self::Item as IntoIterator>::Item) -> bool,
Source§fn cartesian_product<J>(
self,
other: J,
) -> Product<Self, <J as IntoIterator>::IntoIter>
fn cartesian_product<J>( self, other: J, ) -> Product<Self, <J as IntoIterator>::IntoIter>
self and J. Read moreSource§fn multi_cartesian_product(
self,
) -> MultiProduct<<Self::Item as IntoIterator>::IntoIter>where
Self: Sized,
Self::Item: IntoIterator,
<Self::Item as IntoIterator>::IntoIter: Clone,
<Self::Item as IntoIterator>::Item: Clone,
fn multi_cartesian_product(
self,
) -> MultiProduct<<Self::Item as IntoIterator>::IntoIter>where
Self: Sized,
Self::Item: IntoIterator,
<Self::Item as IntoIterator>::IntoIter: Clone,
<Self::Item as IntoIterator>::Item: Clone,
self. Read moreSource§fn coalesce<F>(self, f: F) -> CoalesceBy<Self, F, Self::Item>
fn coalesce<F>(self, f: F) -> CoalesceBy<Self, F, Self::Item>
Source§fn dedup(self) -> CoalesceBy<Self, DedupPred2CoalescePred<DedupEq>, Self::Item>
fn dedup(self) -> CoalesceBy<Self, DedupPred2CoalescePred<DedupEq>, Self::Item>
Source§fn dedup_by<Cmp>(
self,
cmp: Cmp,
) -> CoalesceBy<Self, DedupPred2CoalescePred<Cmp>, Self::Item>
fn dedup_by<Cmp>( self, cmp: Cmp, ) -> CoalesceBy<Self, DedupPred2CoalescePred<Cmp>, Self::Item>
Source§fn dedup_with_count(
self,
) -> CoalesceBy<Self, DedupPredWithCount2CoalescePred<DedupEq>, (usize, Self::Item)>where
Self: Sized,
fn dedup_with_count(
self,
) -> CoalesceBy<Self, DedupPredWithCount2CoalescePred<DedupEq>, (usize, Self::Item)>where
Self: Sized,
Source§fn dedup_by_with_count<Cmp>(
self,
cmp: Cmp,
) -> CoalesceBy<Self, DedupPredWithCount2CoalescePred<Cmp>, (usize, Self::Item)>
fn dedup_by_with_count<Cmp>( self, cmp: Cmp, ) -> CoalesceBy<Self, DedupPredWithCount2CoalescePred<Cmp>, (usize, Self::Item)>
Source§fn duplicates(self) -> DuplicatesBy<Self, Self::Item, ById>
fn duplicates(self) -> DuplicatesBy<Self, Self::Item, ById>
Source§fn duplicates_by<V, F>(self, f: F) -> DuplicatesBy<Self, V, ByFn<F>>
fn duplicates_by<V, F>(self, f: F) -> DuplicatesBy<Self, V, ByFn<F>>
Source§fn unique(self) -> Unique<Self>
fn unique(self) -> Unique<Self>
Source§fn unique_by<V, F>(self, f: F) -> UniqueBy<Self, V, F>
fn unique_by<V, F>(self, f: F) -> UniqueBy<Self, V, F>
Source§fn peeking_take_while<F>(&mut self, accept: F) -> PeekingTakeWhile<'_, Self, F>
fn peeking_take_while<F>(&mut self, accept: F) -> PeekingTakeWhile<'_, Self, F>
accept returns true. Read moreSource§fn take_while_ref<F>(&mut self, accept: F) -> TakeWhileRef<'_, Self, F>
fn take_while_ref<F>(&mut self, accept: F) -> TakeWhileRef<'_, Self, F>
Clone-able iterator
to only pick off elements while the predicate accept returns true. Read moreSource§fn while_some<A>(self) -> WhileSome<Self>
fn while_some<A>(self) -> WhileSome<Self>
Option<A> iterator elements
and produces A. Stops on the first None encountered. Read moreSource§fn tuple_combinations<T>(self) -> TupleCombinations<Self, T>
fn tuple_combinations<T>(self) -> TupleCombinations<Self, T>
Source§fn combinations(self, k: usize) -> Combinations<Self>
fn combinations(self, k: usize) -> Combinations<Self>
k-length combinations of
the elements from an iterator. Read moreSource§fn combinations_with_replacement(
self,
k: usize,
) -> CombinationsWithReplacement<Self>
fn combinations_with_replacement( self, k: usize, ) -> CombinationsWithReplacement<Self>
k-length combinations of
the elements from an iterator, with replacement. Read moreSource§fn permutations(self, k: usize) -> Permutations<Self>
fn permutations(self, k: usize) -> Permutations<Self>
Source§fn powerset(self) -> Powerset<Self>
fn powerset(self) -> Powerset<Self>
Source§fn pad_using<F>(self, min: usize, f: F) -> PadUsing<Self, F>
fn pad_using<F>(self, min: usize, f: F) -> PadUsing<Self, F>
min by filling missing elements using a closure f. Read moreSource§fn with_position(self) -> WithPosition<Self>where
Self: Sized,
fn with_position(self) -> WithPosition<Self>where
Self: Sized,
Position to
ease special-case handling of the first or last elements. Read moreSource§fn positions<P>(self, predicate: P) -> Positions<Self, P>
fn positions<P>(self, predicate: P) -> Positions<Self, P>
Source§fn update<F>(self, updater: F) -> Update<Self, F>
fn update<F>(self, updater: F) -> Update<Self, F>
Source§fn next_tuple<T>(&mut self) -> Option<T>
fn next_tuple<T>(&mut self) -> Option<T>
Source§fn collect_tuple<T>(self) -> Option<T>
fn collect_tuple<T>(self) -> Option<T>
Source§fn find_position<P>(&mut self, pred: P) -> Option<(usize, Self::Item)>
fn find_position<P>(&mut self, pred: P) -> Option<(usize, Self::Item)>
Source§fn find_or_last<P>(self, predicate: P) -> Option<Self::Item>
fn find_or_last<P>(self, predicate: P) -> Option<Self::Item>
Source§fn find_or_first<P>(self, predicate: P) -> Option<Self::Item>
fn find_or_first<P>(self, predicate: P) -> Option<Self::Item>
Source§fn contains<Q>(&mut self, query: &Q) -> bool
fn contains<Q>(&mut self, query: &Q) -> bool
true if the given item is present in this iterator. Read moreSource§fn all_unique(&mut self) -> bool
fn all_unique(&mut self) -> bool
Source§fn dropping(self, n: usize) -> Selfwhere
Self: Sized,
fn dropping(self, n: usize) -> Selfwhere
Self: Sized,
n elements from the iterator eagerly,
and return the same iterator again. Read moreSource§fn dropping_back(self, n: usize) -> Selfwhere
Self: Sized + DoubleEndedIterator,
fn dropping_back(self, n: usize) -> Selfwhere
Self: Sized + DoubleEndedIterator,
n elements from the iterator eagerly,
and return the same iterator again. Read moreSource§fn foreach<F>(self, f: F)
fn foreach<F>(self, f: F)
Use .for_each() instead
f eagerly on each element of the iterator. Read moreSource§fn collect_vec(self) -> Vec<Self::Item>where
Self: Sized,
fn collect_vec(self) -> Vec<Self::Item>where
Self: Sized,
.collect_vec() is simply a type specialization of Iterator::collect,
for convenience.Source§fn try_collect<T, U, E>(self) -> Result<U, E>
fn try_collect<T, U, E>(self) -> Result<U, E>
Source§fn set_from<'a, A, J>(&mut self, from: J) -> usize
fn set_from<'a, A, J>(&mut self, from: J) -> usize
self from the from iterator,
stopping at the shortest of the two iterators. Read moreSource§fn join(&mut self, sep: &str) -> String
fn join(&mut self, sep: &str) -> String
sep. Read moreSource§fn format(self, sep: &str) -> Format<'_, Self>where
Self: Sized,
fn format(self, sep: &str) -> Format<'_, Self>where
Self: Sized,
sep. Read moreSource§fn format_with<F>(self, sep: &str, format: F) -> FormatWith<'_, Self, F>
fn format_with<F>(self, sep: &str, format: F) -> FormatWith<'_, Self, F>
sep. Read moreSource§fn fold_results<A, E, B, F>(&mut self, start: B, f: F) -> Result<B, E>
fn fold_results<A, E, B, F>(&mut self, start: B, f: F) -> Result<B, E>
Use .fold_ok() instead
.fold_ok().Source§fn fold_ok<A, E, B, F>(&mut self, start: B, f: F) -> Result<B, E>
fn fold_ok<A, E, B, F>(&mut self, start: B, f: F) -> Result<B, E>
Result values from an iterator. Read moreSource§fn fold_options<A, B, F>(&mut self, start: B, f: F) -> Option<B>
fn fold_options<A, B, F>(&mut self, start: B, f: F) -> Option<B>
Option values from an iterator. Read moreSource§fn fold1<F>(self, f: F) -> Option<Self::Item>
fn fold1<F>(self, f: F) -> Option<Self::Item>
Use Iterator::reduce instead
Source§fn tree_fold1<F>(self, f: F) -> Option<Self::Item>
fn tree_fold1<F>(self, f: F) -> Option<Self::Item>
Source§fn fold_while<B, F>(&mut self, init: B, f: F) -> FoldWhile<B>
fn fold_while<B, F>(&mut self, init: B, f: F) -> FoldWhile<B>
Source§fn sum1<S>(self) -> Option<S>
fn sum1<S>(self) -> Option<S>
Source§fn product1<P>(self) -> Option<P>
fn product1<P>(self) -> Option<P>
Source§fn sorted_unstable(self) -> IntoIter<Self::Item>
fn sorted_unstable(self) -> IntoIter<Self::Item>
Source§fn sorted_unstable_by<F>(self, cmp: F) -> IntoIter<Self::Item>
fn sorted_unstable_by<F>(self, cmp: F) -> IntoIter<Self::Item>
Source§fn sorted_unstable_by_key<K, F>(self, f: F) -> IntoIter<Self::Item>
fn sorted_unstable_by_key<K, F>(self, f: F) -> IntoIter<Self::Item>
Source§fn sorted(self) -> IntoIter<Self::Item>
fn sorted(self) -> IntoIter<Self::Item>
Source§fn sorted_by<F>(self, cmp: F) -> IntoIter<Self::Item>
fn sorted_by<F>(self, cmp: F) -> IntoIter<Self::Item>
Source§fn sorted_by_key<K, F>(self, f: F) -> IntoIter<Self::Item>
fn sorted_by_key<K, F>(self, f: F) -> IntoIter<Self::Item>
Source§fn sorted_by_cached_key<K, F>(self, f: F) -> IntoIter<Self::Item>
fn sorted_by_cached_key<K, F>(self, f: F) -> IntoIter<Self::Item>
Source§fn k_smallest(self, k: usize) -> IntoIter<Self::Item>
fn k_smallest(self, k: usize) -> IntoIter<Self::Item>
Source§fn partition_map<A, B, F, L, R>(self, predicate: F) -> (A, B)
fn partition_map<A, B, F, L, R>(self, predicate: F) -> (A, B)
Iterator::partition, each partition may
have a distinct type. Read moreSource§fn partition_result<A, B, T, E>(self) -> (A, B)
fn partition_result<A, B, T, E>(self) -> (A, B)
Results into one list of all the Ok elements
and another list of all the Err elements. Read moreSource§fn into_group_map<K, V>(self) -> HashMap<K, Vec<V>>
fn into_group_map<K, V>(self) -> HashMap<K, Vec<V>>
HashMap of keys mapped to Vecs of values. Keys and values
are taken from (Key, Value) tuple pairs yielded by the input iterator. Read moreSource§fn into_group_map_by<K, V, F>(self, f: F) -> HashMap<K, Vec<V>>
fn into_group_map_by<K, V, F>(self, f: F) -> HashMap<K, Vec<V>>
Iterator on a HashMap. Keys mapped to Vecs of values. The key is specified
in the closure. Read moreSource§fn into_grouping_map<K, V>(self) -> GroupingMap<Self>
fn into_grouping_map<K, V>(self) -> GroupingMap<Self>
GroupingMap to be used later with one of the efficient
group-and-fold operations it allows to perform. Read moreSource§fn into_grouping_map_by<K, V, F>(
self,
key_mapper: F,
) -> GroupingMap<MapForGrouping<Self, F>>
fn into_grouping_map_by<K, V, F>( self, key_mapper: F, ) -> GroupingMap<MapForGrouping<Self, F>>
GroupingMap to be used later with one of the efficient
group-and-fold operations it allows to perform. Read moreSource§fn min_set_by<F>(self, compare: F) -> Vec<Self::Item>
fn min_set_by<F>(self, compare: F) -> Vec<Self::Item>
Source§fn min_set_by_key<K, F>(self, key: F) -> Vec<Self::Item>
fn min_set_by_key<K, F>(self, key: F) -> Vec<Self::Item>
Source§fn max_set_by<F>(self, compare: F) -> Vec<Self::Item>
fn max_set_by<F>(self, compare: F) -> Vec<Self::Item>
Source§fn max_set_by_key<K, F>(self, key: F) -> Vec<Self::Item>
fn max_set_by_key<K, F>(self, key: F) -> Vec<Self::Item>
Source§fn minmax(self) -> MinMaxResult<Self::Item>
fn minmax(self) -> MinMaxResult<Self::Item>
Source§fn minmax_by_key<K, F>(self, key: F) -> MinMaxResult<Self::Item>
fn minmax_by_key<K, F>(self, key: F) -> MinMaxResult<Self::Item>
Source§fn minmax_by<F>(self, compare: F) -> MinMaxResult<Self::Item>
fn minmax_by<F>(self, compare: F) -> MinMaxResult<Self::Item>
Source§fn position_max(self) -> Option<usize>
fn position_max(self) -> Option<usize>
Source§fn position_max_by_key<K, F>(self, key: F) -> Option<usize>
fn position_max_by_key<K, F>(self, key: F) -> Option<usize>
Source§fn position_max_by<F>(self, compare: F) -> Option<usize>
fn position_max_by<F>(self, compare: F) -> Option<usize>
Source§fn position_min(self) -> Option<usize>
fn position_min(self) -> Option<usize>
Source§fn position_min_by_key<K, F>(self, key: F) -> Option<usize>
fn position_min_by_key<K, F>(self, key: F) -> Option<usize>
Source§fn position_min_by<F>(self, compare: F) -> Option<usize>
fn position_min_by<F>(self, compare: F) -> Option<usize>
Source§fn position_minmax(self) -> MinMaxResult<usize>
fn position_minmax(self) -> MinMaxResult<usize>
Source§fn position_minmax_by_key<K, F>(self, key: F) -> MinMaxResult<usize>
fn position_minmax_by_key<K, F>(self, key: F) -> MinMaxResult<usize>
Source§fn position_minmax_by<F>(self, compare: F) -> MinMaxResult<usize>
fn position_minmax_by<F>(self, compare: F) -> MinMaxResult<usize>
Source§fn exactly_one(self) -> Result<Self::Item, ExactlyOneError<Self>>where
Self: Sized,
fn exactly_one(self) -> Result<Self::Item, ExactlyOneError<Self>>where
Self: Sized,
Source§fn at_most_one(self) -> Result<Option<Self::Item>, ExactlyOneError<Self>>where
Self: Sized,
fn at_most_one(self) -> Result<Option<Self::Item>, ExactlyOneError<Self>>where
Self: Sized,
Source§fn multipeek(self) -> MultiPeek<Self>where
Self: Sized,
fn multipeek(self) -> MultiPeek<Self>where
Self: Sized,
.next()
values without advancing the base iterator. Read moreSource§fn counts(self) -> HashMap<Self::Item, usize>
fn counts(self) -> HashMap<Self::Item, usize>
HashMap which
contains each item that appears in the iterator and the number
of times it appears. Read moreSource§fn counts_by<K, F>(self, f: F) -> HashMap<K, usize>
fn counts_by<K, F>(self, f: F) -> HashMap<K, usize>
HashMap which
contains each item that appears in the iterator and the number
of times it appears,
determining identity using a keying function. Read moreSource§fn multiunzip<FromI>(self) -> FromIwhere
Self: Sized + MultiUnzip<FromI>,
fn multiunzip<FromI>(self) -> FromIwhere
Self: Sized + MultiUnzip<FromI>,
§impl<T> Pointable for T
impl<T> Pointable for T
Source§impl<I> SymCurveIterator for I
impl<I> SymCurveIterator for I
Source§fn sym_curve_iter(self, win: usize, step: usize) -> SymCurveIter<Self> ⓘ
fn sym_curve_iter(self, win: usize, step: usize) -> SymCurveIter<Self> ⓘ
SymCurveIter. Read more