Skip to main content

CurveIter

Struct CurveIter 

Source
pub struct CurveIter<I: Iterator<Item = u8>> { /* private fields */ }
Expand description

An iterator that computes the curvature of a DNA sequence.

CurveIter wraps an iterator that yields u8 and computes the curvature of the DNA sequence represented by the nucleotides.

§Fields

  • inner: The inner iterator that yields u8.

Implementations§

Source§

impl<I: Iterator<Item = u8>> CurveIter<I>

Construct a CurveIter from an iterator that yields u8.

This function constructs a CurveIter from an iterator that yields u8. The CurveIter computes the curvature of the DNA sequence represented by the nucleotides.

§Parameters

  • seq_iter: An iterator that yields u8.
  • roll_type: The type of roll (either simple or activated).
  • step_b: Half of the window size minus one. In other words, 2 * step_size + 1 is the size of the window.
  • step_c: The distance from the midpoint base to the sides in the curve window.
Source

pub fn new( seq_iter: I, roll_type: RollType, step_b: usize, step_c: usize, curve_scale: f64, ) -> Self

Build a curvature iterator over a stream of bases.

Bases must be A, C, G or T in either case; anything else will panic, so split a record with crate::fasta::split_seq_by_gaps first. For scoring whole records use crate::curve::scan, which handles splitting, positions and threading.

The first step_b + step_c + 1 bases and the last of the same produce no value, because the windows need context on both sides.

use symcurve::curve::iters::CurveIter;
use symcurve::curve::matrix::RollType;

let seq = b"CCAACATTTTGACTTTTTGGGAGGGCACTAGCACCTATCTACCCTGAATC";
let curves: Vec<f64> =
    CurveIter::new(seq.iter().copied(), RollType::Simple, 5, 15, 0.33335).collect();
assert_eq!(curves.len(), seq.len() - 2 * (5 + 15 + 1));

Trait Implementations§

Source§

impl<I: Iterator<Item = u8>> FusedIterator for CurveIter<I>

Source§

impl<I: Iterator<Item = u8>> Iterator for CurveIter<I>

Source§

fn next(&mut self) -> Option<Self::Item>

Computes the next item of the curvature iterator.

Source§

type Item = f64

The type of the elements being iterated over.
Source§

fn size_hint(&self) -> (usize, Option<usize>)

Returns the bounds on the remaining length of the iterator. Read more
Source§

fn next_chunk<const N: usize>( &mut self, ) -> Result<[Self::Item; N], IntoIter<Self::Item, N>>
where Self: Sized,

🔬This is a nightly-only experimental API. (iter_next_chunk)
Advances the iterator and returns an array containing the next N values. Read more
1.0.0 (const: unstable) · Source§

fn count(self) -> usize
where Self: Sized,

Consumes the iterator, counting the number of iterations and returning it. Read more
1.0.0 (const: unstable) · Source§

fn last(self) -> Option<Self::Item>
where Self: Sized,

Consumes the iterator, returning the last element. Read more
Source§

fn advance_by(&mut self, n: usize) -> Result<(), NonZero<usize>>

🔬This is a nightly-only experimental API. (iter_advance_by)
Advances the iterator by n elements. Read more
1.0.0 (const: unstable) · Source§

fn nth(&mut self, n: usize) -> Option<Self::Item>

Returns the nth element of the iterator. Read more
1.28.0 (const: unstable) · Source§

fn step_by(self, step: usize) -> StepBy<Self>
where Self: Sized,

Creates an iterator starting at the same point, but stepping by the given amount at each iteration. Read more
1.0.0 (const: unstable) · Source§

fn chain<U>(self, other: U) -> Chain<Self, <U as IntoIterator>::IntoIter>
where Self: Sized, U: IntoIterator<Item = Self::Item>,

Takes two iterators and creates a new iterator over both in sequence. Read more
1.0.0 (const: unstable) · Source§

fn zip<U>(self, other: U) -> Zip<Self, <U as IntoIterator>::IntoIter>
where Self: Sized, U: IntoIterator,

‘Zips up’ two iterators into a single iterator of pairs. Read more
Source§

fn intersperse(self, separator: Self::Item) -> Intersperse<Self>
where Self: Sized, Self::Item: Clone,

🔬This is a nightly-only experimental API. (iter_intersperse)
Creates a new iterator which places a copy of separator between items of the original iterator. Read more
Source§

fn intersperse_with<G>(self, separator: G) -> IntersperseWith<Self, G>
where Self: Sized, G: FnMut() -> Self::Item,

🔬This is a nightly-only experimental API. (iter_intersperse)
Creates a new iterator which places an item generated by separator between items of the original iterator. Read more
1.0.0 (const: unstable) · Source§

fn map<B, F>(self, f: F) -> Map<Self, F>
where Self: Sized, F: FnMut(Self::Item) -> B,

Takes a closure and creates an iterator which calls that closure on each element. Read more
1.21.0 (const: unstable) · Source§

fn for_each<F>(self, f: F)
where Self: Sized, F: FnMut(Self::Item),

Calls a closure on each element of an iterator. Read more
1.0.0 (const: unstable) · Source§

fn filter<P>(self, predicate: P) -> Filter<Self, P>
where Self: Sized, P: FnMut(&Self::Item) -> bool,

Creates an iterator which uses a closure to determine if an element should be yielded. Read more
1.0.0 (const: unstable) · Source§

fn filter_map<B, F>(self, f: F) -> FilterMap<Self, F>
where Self: Sized, F: FnMut(Self::Item) -> Option<B>,

Creates an iterator that both filters and maps. Read more
1.0.0 (const: unstable) · Source§

fn enumerate(self) -> Enumerate<Self>
where Self: Sized,

Creates an iterator which gives the current iteration count as well as the next value. Read more
1.0.0 (const: unstable) · Source§

fn peekable(self) -> Peekable<Self>
where Self: Sized,

Creates an iterator which can use the peek and peek_mut methods to look at the next element of the iterator without consuming it. See their documentation for more information. Read more
1.0.0 (const: unstable) · Source§

fn skip_while<P>(self, predicate: P) -> SkipWhile<Self, P>
where Self: Sized, P: FnMut(&Self::Item) -> bool,

Creates an iterator that skips elements based on a predicate. Read more
1.0.0 (const: unstable) · Source§

fn take_while<P>(self, predicate: P) -> TakeWhile<Self, P>
where Self: Sized, P: FnMut(&Self::Item) -> bool,

Creates an iterator that yields elements based on a predicate. Read more
1.57.0 (const: unstable) · Source§

fn map_while<B, P>(self, predicate: P) -> MapWhile<Self, P>
where Self: Sized, P: FnMut(Self::Item) -> Option<B>,

Creates an iterator that both yields elements based on a predicate and maps. Read more
1.0.0 (const: unstable) · Source§

fn skip(self, n: usize) -> Skip<Self>
where Self: Sized,

Creates an iterator that skips the first n elements. Read more
1.0.0 (const: unstable) · Source§

fn take(self, n: usize) -> Take<Self>
where Self: Sized,

Creates an iterator that yields the first n elements, or fewer if the underlying iterator ends sooner. Read more
1.0.0 (const: unstable) · Source§

fn scan<St, B, F>(self, initial_state: St, f: F) -> Scan<Self, St, F>
where Self: Sized, F: FnMut(&mut St, Self::Item) -> Option<B>,

An iterator adapter which, like fold, holds internal state, but unlike fold, produces a new iterator. Read more
1.0.0 (const: unstable) · Source§

fn flat_map<U, F>(self, f: F) -> FlatMap<Self, U, F>
where Self: Sized, U: IntoIterator, F: FnMut(Self::Item) -> U,

Creates an iterator that works like map, but flattens nested structure. Read more
1.29.0 (const: unstable) · Source§

fn flatten(self) -> Flatten<Self>
where Self: Sized, Self::Item: IntoIterator,

Creates an iterator that flattens nested structure. Read more
Source§

fn map_windows<F, R, const N: usize>(self, f: F) -> MapWindows<Self, F, N>
where Self: Sized, F: FnMut(&[Self::Item; N]) -> R,

🔬This is a nightly-only experimental API. (iter_map_windows)
Calls the given function f for each contiguous window of size N over self and returns an iterator over the outputs of f. Like slice::windows(), the windows during mapping overlap as well. Read more
1.0.0 (const: unstable) · Source§

fn fuse(self) -> Fuse<Self>
where Self: Sized,

Creates an iterator which ends after the first None. Read more
1.0.0 (const: unstable) · Source§

fn inspect<F>(self, f: F) -> Inspect<Self, F>
where Self: Sized, F: FnMut(&Self::Item),

Does something with each element of an iterator, passing the value on. Read more
1.0.0 (const: unstable) · Source§

fn by_ref(&mut self) -> &mut Self
where Self: Sized,

Creates a “by reference” adapter for this instance of Iterator. Read more
1.0.0 (const: unstable) · Source§

fn collect<B>(self) -> B
where B: FromIterator<Self::Item>, Self: Sized,

Transforms an iterator into a collection. Read more
Source§

fn try_collect<B>( &mut self, ) -> <<Self::Item as Try>::Residual as Residual<B>>::TryType
where Self: Sized, Self::Item: Try, <Self::Item as Try>::Residual: Residual<B>, B: FromIterator<<Self::Item as Try>::Output>,

🔬This is a nightly-only experimental API. (iterator_try_collect)
Fallibly transforms an iterator into a collection, short circuiting if a failure is encountered. Read more
Source§

fn collect_into<E>(self, collection: &mut E) -> &mut E
where E: Extend<Self::Item>, Self: Sized,

🔬This is a nightly-only experimental API. (iter_collect_into)
Collects all the items from an iterator into a collection. Read more
1.0.0 (const: unstable) · Source§

fn partition<B, F>(self, f: F) -> (B, B)
where Self: Sized, B: Default + Extend<Self::Item>, F: FnMut(&Self::Item) -> bool,

Consumes an iterator, creating two collections from it. Read more
Source§

fn is_partitioned<P>(self, predicate: P) -> bool
where Self: Sized, P: FnMut(Self::Item) -> bool,

🔬This is a nightly-only experimental API. (iter_is_partitioned)
Checks if the elements of this iterator are partitioned according to the given predicate, such that all those that return true precede all those that return false. Read more
1.27.0 (const: unstable) · Source§

fn try_fold<B, F, R>(&mut self, init: B, f: F) -> R
where Self: Sized, F: FnMut(B, Self::Item) -> R, R: Try<Output = B>,

An iterator method that applies a function as long as it returns successfully, producing a single, final value. Read more
1.27.0 (const: unstable) · Source§

fn try_for_each<F, R>(&mut self, f: F) -> R
where Self: Sized, F: FnMut(Self::Item) -> R, R: Try<Output = ()>,

An iterator method that applies a fallible function to each item in the iterator, stopping at the first error and returning that error. Read more
1.0.0 (const: unstable) · Source§

fn fold<B, F>(self, init: B, f: F) -> B
where Self: Sized, F: FnMut(B, Self::Item) -> B,

Folds every element into an accumulator by applying an operation, returning the final result. Read more
1.51.0 (const: unstable) · Source§

fn reduce<F>(self, f: F) -> Option<Self::Item>
where Self: Sized, F: FnMut(Self::Item, Self::Item) -> Self::Item,

Reduces the elements to a single one, by repeatedly applying a reducing operation. Read more
Source§

fn try_reduce<R>( &mut self, f: impl FnMut(Self::Item, Self::Item) -> R, ) -> <<R as Try>::Residual as Residual<Option<<R as Try>::Output>>>::TryType
where Self: Sized, R: Try<Output = Self::Item>, <R as Try>::Residual: Residual<Option<Self::Item>>,

🔬This is a nightly-only experimental API. (iterator_try_reduce)
Reduces the elements to a single one by repeatedly applying a reducing operation. If the closure returns a failure, the failure is propagated back to the caller immediately. Read more
1.0.0 (const: unstable) · Source§

fn all<F>(&mut self, f: F) -> bool
where Self: Sized, F: FnMut(Self::Item) -> bool,

Tests if every element of the iterator matches a predicate. Read more
1.0.0 (const: unstable) · Source§

fn any<F>(&mut self, f: F) -> bool
where Self: Sized, F: FnMut(Self::Item) -> bool,

Tests if any element of the iterator matches a predicate. Read more
1.0.0 (const: unstable) · Source§

fn find<P>(&mut self, predicate: P) -> Option<Self::Item>
where Self: Sized, P: FnMut(&Self::Item) -> bool,

Searches for an element of an iterator that satisfies a predicate. Read more
1.30.0 (const: unstable) · Source§

fn find_map<B, F>(&mut self, f: F) -> Option<B>
where Self: Sized, F: FnMut(Self::Item) -> Option<B>,

Applies function to the elements of iterator and returns the first non-none result. Read more
Source§

fn try_find<R>( &mut self, f: impl FnMut(&Self::Item) -> R, ) -> <<R as Try>::Residual as Residual<Option<Self::Item>>>::TryType
where Self: Sized, R: Try<Output = bool>, <R as Try>::Residual: Residual<Option<Self::Item>>,

🔬This is a nightly-only experimental API. (try_find)
Applies function to the elements of iterator and returns the first true result or the first error. Read more
1.0.0 (const: unstable) · Source§

fn position<P>(&mut self, predicate: P) -> Option<usize>
where Self: Sized, P: FnMut(Self::Item) -> bool,

Searches for an element in an iterator, returning its index. Read more
1.0.0 (const: unstable) · Source§

fn max(self) -> Option<Self::Item>
where Self: Sized, Self::Item: Ord,

Returns the maximum element of an iterator. Read more
1.0.0 (const: unstable) · Source§

fn min(self) -> Option<Self::Item>
where Self: Sized, Self::Item: Ord,

Returns the minimum element of an iterator. Read more
1.6.0 (const: unstable) · Source§

fn max_by_key<B, F>(self, f: F) -> Option<Self::Item>
where B: Ord, Self: Sized, F: FnMut(&Self::Item) -> B,

Returns the element that gives the maximum value from the specified function. Read more
1.15.0 (const: unstable) · Source§

fn max_by<F>(self, compare: F) -> Option<Self::Item>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Returns the element that gives the maximum value with respect to the specified comparison function. Read more
1.6.0 (const: unstable) · Source§

fn min_by_key<B, F>(self, f: F) -> Option<Self::Item>
where B: Ord, Self: Sized, F: FnMut(&Self::Item) -> B,

Returns the element that gives the minimum value from the specified function. Read more
1.15.0 (const: unstable) · Source§

fn min_by<F>(self, compare: F) -> Option<Self::Item>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Returns the element that gives the minimum value with respect to the specified comparison function. Read more
1.0.0 (const: unstable) · Source§

fn unzip<A, B, FromA, FromB>(self) -> (FromA, FromB)
where FromA: Default + Extend<A>, FromB: Default + Extend<B>, Self: Sized + Iterator<Item = (A, B)>,

Converts an iterator of pairs into a pair of containers. Read more
1.36.0 (const: unstable) · Source§

fn copied<'a, T>(self) -> Copied<Self>
where T: Copy + 'a, Self: Sized + Iterator<Item = &'a T>,

Creates an iterator which copies all of its elements. Read more
1.0.0 (const: unstable) · Source§

fn cloned<'a, T>(self) -> Cloned<Self>
where T: Clone + 'a, Self: Sized + Iterator<Item = &'a T>,

Creates an iterator which clones all of its elements. Read more
Source§

fn array_chunks<const N: usize>(self) -> ArrayChunks<Self, N>
where Self: Sized,

🔬This is a nightly-only experimental API. (iter_array_chunks)
Returns an iterator over N elements of the iterator at a time. Read more
1.11.0 (const: unstable) · Source§

fn sum<S>(self) -> S
where Self: Sized, S: Sum<Self::Item>,

Sums the elements of an iterator. Read more
1.11.0 (const: unstable) · Source§

fn product<P>(self) -> P
where Self: Sized, P: Product<Self::Item>,

Iterates over the entire iterator, multiplying all the elements. Read more
1.5.0 (const: unstable) · Source§

fn cmp<I>(self, other: I) -> Ordering
where I: IntoIterator<Item = Self::Item>, Self::Item: Ord, Self: Sized,

Lexicographically compares the elements of this Iterator with those of another. Read more
Source§

fn cmp_by<I, F>(self, other: I, cmp: F) -> Ordering
where Self: Sized, I: IntoIterator, F: FnMut(Self::Item, <I as IntoIterator>::Item) -> Ordering,

🔬This is a nightly-only experimental API. (iter_order_by)
Lexicographically compares the elements of this Iterator with those of another with respect to the specified comparison function. Read more
1.5.0 (const: unstable) · Source§

fn partial_cmp<I>(self, other: I) -> Option<Ordering>
where I: IntoIterator, Self::Item: PartialOrd<<I as IntoIterator>::Item>, Self: Sized,

Lexicographically compares the PartialOrd elements of this Iterator with those of another. The comparison works like short-circuit evaluation, returning a result without comparing the remaining elements. As soon as an order can be determined, the evaluation stops and a result is returned. Read more
Source§

fn partial_cmp_by<I, F>(self, other: I, partial_cmp: F) -> Option<Ordering>
where Self: Sized, I: IntoIterator, F: FnMut(Self::Item, <I as IntoIterator>::Item) -> Option<Ordering>,

🔬This is a nightly-only experimental API. (iter_order_by)
Lexicographically compares the elements of this Iterator with those of another with respect to the specified comparison function. Read more
1.5.0 (const: unstable) · Source§

fn eq<I>(self, other: I) -> bool
where I: IntoIterator, Self::Item: PartialEq<<I as IntoIterator>::Item>, Self: Sized,

Determines if the elements of this Iterator are equal to those of another. Read more
Source§

fn eq_by<I, F>(self, other: I, eq: F) -> bool
where Self: Sized, I: IntoIterator, F: FnMut(Self::Item, <I as IntoIterator>::Item) -> bool,

🔬This is a nightly-only experimental API. (iter_order_by)
Determines if the elements of this Iterator are equal to those of another with respect to the specified equality function. Read more
1.5.0 (const: unstable) · Source§

fn ne<I>(self, other: I) -> bool
where I: IntoIterator, Self::Item: PartialEq<<I as IntoIterator>::Item>, Self: Sized,

Determines if the elements of this Iterator are not equal to those of another. Read more
1.5.0 (const: unstable) · Source§

fn lt<I>(self, other: I) -> bool
where I: IntoIterator, Self::Item: PartialOrd<<I as IntoIterator>::Item>, Self: Sized,

Determines if the elements of this Iterator are lexicographically less than those of another. Read more
1.5.0 (const: unstable) · Source§

fn le<I>(self, other: I) -> bool
where I: IntoIterator, Self::Item: PartialOrd<<I as IntoIterator>::Item>, Self: Sized,

Determines if the elements of this Iterator are lexicographically less or equal to those of another. Read more
1.5.0 (const: unstable) · Source§

fn gt<I>(self, other: I) -> bool
where I: IntoIterator, Self::Item: PartialOrd<<I as IntoIterator>::Item>, Self: Sized,

Determines if the elements of this Iterator are lexicographically greater than those of another. Read more
1.5.0 (const: unstable) · Source§

fn ge<I>(self, other: I) -> bool
where I: IntoIterator, Self::Item: PartialOrd<<I as IntoIterator>::Item>, Self: Sized,

Determines if the elements of this Iterator are lexicographically greater than or equal to those of another. Read more
1.82.0 (const: unstable) · Source§

fn is_sorted(self) -> bool
where Self: Sized, Self::Item: PartialOrd,

Checks if the elements of this iterator are sorted. Read more
1.82.0 (const: unstable) · Source§

fn is_sorted_by<F>(self, compare: F) -> bool
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> bool,

Checks if the elements of this iterator are sorted using the given comparator function. Read more
1.82.0 (const: unstable) · Source§

fn is_sorted_by_key<F, K>(self, f: F) -> bool
where Self: Sized, F: FnMut(Self::Item) -> K, K: PartialOrd,

Checks if the elements of this iterator are sorted using the given key extraction function. Read more

Auto Trait Implementations§

§

impl<I> Freeze for CurveIter<I>
where I: Freeze,

§

impl<I> RefUnwindSafe for CurveIter<I>
where I: RefUnwindSafe,

§

impl<I> Send for CurveIter<I>
where I: Send,

§

impl<I> Sync for CurveIter<I>
where I: Sync,

§

impl<I> Unpin for CurveIter<I>
where I: Unpin,

§

impl<I> UnsafeUnpin for CurveIter<I>
where I: UnsafeUnpin,

§

impl<I> UnwindSafe for CurveIter<I>
where I: UnwindSafe,

Blanket Implementations§

Source§

impl<T> Any for T
where T: 'static + ?Sized,

Source§

fn type_id(&self) -> TypeId

Gets the TypeId of self. Read more
Source§

impl<T> Borrow<T> for T
where T: ?Sized,

Source§

fn borrow(&self) -> &T

Immutably borrows from an owned value. Read more
Source§

impl<T> BorrowMut<T> for T
where T: ?Sized,

Source§

fn borrow_mut(&mut self) -> &mut T

Mutably borrows from an owned value. Read more
Source§

impl<T> From<T> for T

Source§

fn from(t: T) -> T

Returns the argument unchanged.

Source§

impl<T, U> Into<U> for T
where U: From<T>,

Source§

fn into(self) -> U

Calls U::from(self).

That is, this conversion is whatever the implementation of From<T> for U chooses to do.

Source§

impl<T> IntoEither for T

Source§

fn into_either(self, into_left: bool) -> Either<Self, Self>

Converts self into a Left variant of Either<Self, Self> if into_left is true. Converts self into a Right variant of Either<Self, Self> otherwise. Read more
Source§

fn into_either_with<F>(self, into_left: F) -> Either<Self, Self>
where F: FnOnce(&Self) -> bool,

Converts self into a Left variant of Either<Self, Self> if into_left(&self) returns true. Converts self into a Right variant of Either<Self, Self> otherwise. Read more
Source§

impl<I> IntoIterator for I
where I: Iterator,

Source§

type Item = <I as Iterator>::Item

The type of the elements being iterated over.
Source§

type IntoIter = I

Which kind of iterator are we turning this into?
Source§

fn into_iter(self) -> I

Creates an iterator from a value. Read more
Source§

impl<T> Itertools for T
where T: Iterator + ?Sized,

Source§

fn interleave<J>( self, other: J, ) -> Interleave<Self, <J as IntoIterator>::IntoIter>
where J: IntoIterator<Item = Self::Item>, Self: Sized,

Alternate elements from two iterators until both have run out. Read more
Source§

fn interleave_shortest<J>( self, other: J, ) -> InterleaveShortest<Self, <J as IntoIterator>::IntoIter>
where J: IntoIterator<Item = Self::Item>, Self: Sized,

Alternate elements from two iterators until at least one of them has run out. Read more
Source§

fn intersperse( self, element: Self::Item, ) -> IntersperseWith<Self, IntersperseElementSimple<Self::Item>>
where Self: Sized, Self::Item: Clone,

An iterator adaptor to insert a particular value between each element of the adapted iterator. Read more
Source§

fn intersperse_with<F>(self, element: F) -> IntersperseWith<Self, F>
where Self: Sized, F: FnMut() -> Self::Item,

An iterator adaptor to insert a particular value created by a function between each element of the adapted iterator. Read more
Source§

fn zip_longest<J>( self, other: J, ) -> ZipLongest<Self, <J as IntoIterator>::IntoIter>
where J: IntoIterator, Self: Sized,

Create an iterator which iterates over both this and the specified iterator simultaneously, yielding pairs of two optional elements. Read more
Source§

fn zip_eq<J>(self, other: J) -> ZipEq<Self, <J as IntoIterator>::IntoIter>
where J: IntoIterator, Self: Sized,

Create an iterator which iterates over both this and the specified iterator simultaneously, yielding pairs of elements. Read more
Source§

fn batching<B, F>(self, f: F) -> Batching<Self, F>
where F: FnMut(&mut Self) -> Option<B>, Self: Sized,

A “meta iterator adaptor”. Its closure receives a reference to the iterator and may pick off as many elements as it likes, to produce the next iterator element. Read more
Source§

fn group_by<K, F>(self, key: F) -> GroupBy<K, Self, F>
where Self: Sized, F: FnMut(&Self::Item) -> K, K: PartialEq,

Return an iterable that can group iterator elements. Consecutive elements that map to the same key (“runs”), are assigned to the same group. Read more
Source§

fn chunks(self, size: usize) -> IntoChunks<Self>
where Self: Sized,

Return an iterable that can chunk the iterator. Read more
Source§

fn tuple_windows<T>(self) -> TupleWindows<Self, T>
where Self: Sized + Iterator<Item = <T as TupleCollect>::Item>, T: HomogeneousTuple, <T as TupleCollect>::Item: Clone,

Return an iterator over all contiguous windows producing tuples of a specific size (up to 12). Read more
Source§

fn circular_tuple_windows<T>(self) -> CircularTupleWindows<Self, T>
where Self: Sized + Clone + Iterator<Item = <T as TupleCollect>::Item> + ExactSizeIterator, T: TupleCollect + Clone, <T as TupleCollect>::Item: Clone,

Return an iterator over all windows, wrapping back to the first elements when the window would otherwise exceed the length of the iterator, producing tuples of a specific size (up to 12). Read more
Source§

fn tuples<T>(self) -> Tuples<Self, T>
where Self: Sized + Iterator<Item = <T as TupleCollect>::Item>, T: HomogeneousTuple,

Return an iterator that groups the items in tuples of a specific size (up to 12). Read more
Source§

fn tee(self) -> (Tee<Self>, Tee<Self>)
where Self: Sized, Self::Item: Clone,

Split into an iterator pair that both yield all elements from the original iterator. Read more
Source§

fn step(self, n: usize) -> Step<Self>
where Self: Sized,

👎Deprecated since 0.8.0:

Use std .step_by() instead

Return an iterator adaptor that steps n elements in the base iterator for each iteration. Read more
Source§

fn map_into<R>(self) -> MapSpecialCase<Self, MapSpecialCaseFnInto<R>>
where Self: Sized, Self::Item: Into<R>,

Convert each item of the iterator using the Into trait. Read more
Source§

fn map_results<F, T, U, E>( self, f: F, ) -> MapSpecialCase<Self, MapSpecialCaseFnOk<F>>
where Self: Sized + Iterator<Item = Result<T, E>>, F: FnMut(T) -> U,

👎Deprecated since 0.10.0:

Use .map_ok() instead

Source§

fn map_ok<F, T, U, E>(self, f: F) -> MapSpecialCase<Self, MapSpecialCaseFnOk<F>>
where Self: Sized + Iterator<Item = Result<T, E>>, F: FnMut(T) -> U,

Return an iterator adaptor that applies the provided closure to every Result::Ok value. Result::Err values are unchanged. Read more
Source§

fn filter_ok<F, T, E>(self, f: F) -> FilterOk<Self, F>
where Self: Sized + Iterator<Item = Result<T, E>>, F: FnMut(&T) -> bool,

Return an iterator adaptor that filters every Result::Ok value with the provided closure. Result::Err values are unchanged. Read more
Source§

fn filter_map_ok<F, T, U, E>(self, f: F) -> FilterMapOk<Self, F>
where Self: Sized + Iterator<Item = Result<T, E>>, F: FnMut(T) -> Option<U>,

Return an iterator adaptor that filters and transforms every Result::Ok value with the provided closure. Result::Err values are unchanged. Read more
Source§

fn flatten_ok<T, E>(self) -> FlattenOk<Self, T, E>
where Self: Sized + Iterator<Item = Result<T, E>>, T: IntoIterator,

Return an iterator adaptor that flattens every Result::Ok value into a series of Result::Ok values. Result::Err values are unchanged. Read more
Source§

fn merge<J>( self, other: J, ) -> MergeBy<Self, <J as IntoIterator>::IntoIter, MergeLte>
where Self: Sized, Self::Item: PartialOrd, J: IntoIterator<Item = Self::Item>,

Return an iterator adaptor that merges the two base iterators in ascending order. If both base iterators are sorted (ascending), the result is sorted. Read more
Source§

fn merge_by<J, F>( self, other: J, is_first: F, ) -> MergeBy<Self, <J as IntoIterator>::IntoIter, F>
where Self: Sized, J: IntoIterator<Item = Self::Item>, F: FnMut(&Self::Item, &Self::Item) -> bool,

Return an iterator adaptor that merges the two base iterators in order. This is much like .merge() but allows for a custom ordering. Read more
Source§

fn merge_join_by<J, F>( self, other: J, cmp_fn: F, ) -> MergeJoinBy<Self, <J as IntoIterator>::IntoIter, F>
where J: IntoIterator, F: FnMut(&Self::Item, &<J as IntoIterator>::Item) -> Ordering, Self: Sized,

Create an iterator that merges items from both this and the specified iterator in ascending order. Read more
Source§

fn kmerge(self) -> KMergeBy<<Self::Item as IntoIterator>::IntoIter, KMergeByLt>
where Self: Sized, Self::Item: IntoIterator, <Self::Item as IntoIterator>::Item: PartialOrd,

Return an iterator adaptor that flattens an iterator of iterators by merging them in ascending order. Read more
Source§

fn kmerge_by<F>( self, first: F, ) -> KMergeBy<<Self::Item as IntoIterator>::IntoIter, F>
where Self: Sized, Self::Item: IntoIterator, F: FnMut(&<Self::Item as IntoIterator>::Item, &<Self::Item as IntoIterator>::Item) -> bool,

Return an iterator adaptor that flattens an iterator of iterators by merging them according to the given closure. Read more
Source§

fn cartesian_product<J>( self, other: J, ) -> Product<Self, <J as IntoIterator>::IntoIter>
where Self: Sized, Self::Item: Clone, J: IntoIterator, <J as IntoIterator>::IntoIter: Clone,

Return an iterator adaptor that iterates over the cartesian product of the element sets of two iterators self and J. Read more
Source§

fn multi_cartesian_product( self, ) -> MultiProduct<<Self::Item as IntoIterator>::IntoIter>
where Self: Sized, Self::Item: IntoIterator, <Self::Item as IntoIterator>::IntoIter: Clone, <Self::Item as IntoIterator>::Item: Clone,

Return an iterator adaptor that iterates over the cartesian product of all subiterators returned by meta-iterator self. Read more
Source§

fn coalesce<F>(self, f: F) -> CoalesceBy<Self, F, Self::Item>
where Self: Sized, F: FnMut(Self::Item, Self::Item) -> Result<Self::Item, (Self::Item, Self::Item)>,

Return an iterator adaptor that uses the passed-in closure to optionally merge together consecutive elements. Read more
Source§

fn dedup(self) -> CoalesceBy<Self, DedupPred2CoalescePred<DedupEq>, Self::Item>
where Self: Sized, Self::Item: PartialEq,

Remove duplicates from sections of consecutive identical elements. If the iterator is sorted, all elements will be unique. Read more
Source§

fn dedup_by<Cmp>( self, cmp: Cmp, ) -> CoalesceBy<Self, DedupPred2CoalescePred<Cmp>, Self::Item>
where Self: Sized, Cmp: FnMut(&Self::Item, &Self::Item) -> bool,

Remove duplicates from sections of consecutive identical elements, determining equality using a comparison function. If the iterator is sorted, all elements will be unique. Read more
Source§

fn dedup_with_count( self, ) -> CoalesceBy<Self, DedupPredWithCount2CoalescePred<DedupEq>, (usize, Self::Item)>
where Self: Sized,

Remove duplicates from sections of consecutive identical elements, while keeping a count of how many repeated elements were present. If the iterator is sorted, all elements will be unique. Read more
Source§

fn dedup_by_with_count<Cmp>( self, cmp: Cmp, ) -> CoalesceBy<Self, DedupPredWithCount2CoalescePred<Cmp>, (usize, Self::Item)>
where Self: Sized, Cmp: FnMut(&Self::Item, &Self::Item) -> bool,

Remove duplicates from sections of consecutive identical elements, while keeping a count of how many repeated elements were present. This will determine equality using a comparison function. If the iterator is sorted, all elements will be unique. Read more
Source§

fn duplicates(self) -> DuplicatesBy<Self, Self::Item, ById>
where Self: Sized, Self::Item: Eq + Hash,

Return an iterator adaptor that produces elements that appear more than once during the iteration. Duplicates are detected using hash and equality. Read more
Source§

fn duplicates_by<V, F>(self, f: F) -> DuplicatesBy<Self, V, ByFn<F>>
where Self: Sized, V: Eq + Hash, F: FnMut(&Self::Item) -> V,

Return an iterator adaptor that produces elements that appear more than once during the iteration. Duplicates are detected using hash and equality. Read more
Source§

fn unique(self) -> Unique<Self>
where Self: Sized, Self::Item: Clone + Eq + Hash,

Return an iterator adaptor that filters out elements that have already been produced once during the iteration. Duplicates are detected using hash and equality. Read more
Source§

fn unique_by<V, F>(self, f: F) -> UniqueBy<Self, V, F>
where Self: Sized, V: Eq + Hash, F: FnMut(&Self::Item) -> V,

Return an iterator adaptor that filters out elements that have already been produced once during the iteration. Read more
Source§

fn peeking_take_while<F>(&mut self, accept: F) -> PeekingTakeWhile<'_, Self, F>
where Self: Sized + PeekingNext, F: FnMut(&Self::Item) -> bool,

Return an iterator adaptor that borrows from this iterator and takes items while the closure accept returns true. Read more
Source§

fn take_while_ref<F>(&mut self, accept: F) -> TakeWhileRef<'_, Self, F>
where Self: Clone, F: FnMut(&Self::Item) -> bool,

Return an iterator adaptor that borrows from a Clone-able iterator to only pick off elements while the predicate accept returns true. Read more
Source§

fn while_some<A>(self) -> WhileSome<Self>
where Self: Sized + Iterator<Item = Option<A>>,

Return an iterator adaptor that filters Option<A> iterator elements and produces A. Stops on the first None encountered. Read more
Source§

fn tuple_combinations<T>(self) -> TupleCombinations<Self, T>
where Self: Sized + Clone, Self::Item: Clone, T: HasCombination<Self>,

Return an iterator adaptor that iterates over the combinations of the elements from an iterator. Read more
Source§

fn combinations(self, k: usize) -> Combinations<Self>
where Self: Sized, Self::Item: Clone,

Return an iterator adaptor that iterates over the k-length combinations of the elements from an iterator. Read more
Source§

fn combinations_with_replacement( self, k: usize, ) -> CombinationsWithReplacement<Self>
where Self: Sized, Self::Item: Clone,

Return an iterator that iterates over the k-length combinations of the elements from an iterator, with replacement. Read more
Source§

fn permutations(self, k: usize) -> Permutations<Self>
where Self: Sized, Self::Item: Clone,

Return an iterator adaptor that iterates over all k-permutations of the elements from an iterator. Read more
Source§

fn powerset(self) -> Powerset<Self>
where Self: Sized, Self::Item: Clone,

Return an iterator that iterates through the powerset of the elements from an iterator. Read more
Source§

fn pad_using<F>(self, min: usize, f: F) -> PadUsing<Self, F>
where Self: Sized, F: FnMut(usize) -> Self::Item,

Return an iterator adaptor that pads the sequence to a minimum length of min by filling missing elements using a closure f. Read more
Source§

fn with_position(self) -> WithPosition<Self>
where Self: Sized,

Return an iterator adaptor that wraps each element in a Position to ease special-case handling of the first or last elements. Read more
Source§

fn positions<P>(self, predicate: P) -> Positions<Self, P>
where Self: Sized, P: FnMut(Self::Item) -> bool,

Return an iterator adaptor that yields the indices of all elements satisfying a predicate, counted from the start of the iterator. Read more
Source§

fn update<F>(self, updater: F) -> Update<Self, F>
where Self: Sized, F: FnMut(&mut Self::Item),

Return an iterator adaptor that applies a mutating function to each element before yielding it. Read more
Source§

fn next_tuple<T>(&mut self) -> Option<T>
where Self: Sized + Iterator<Item = <T as TupleCollect>::Item>, T: HomogeneousTuple,

Advances the iterator and returns the next items grouped in a tuple of a specific size (up to 12). Read more
Source§

fn collect_tuple<T>(self) -> Option<T>
where Self: Sized + Iterator<Item = <T as TupleCollect>::Item>, T: HomogeneousTuple,

Collects all items from the iterator into a tuple of a specific size (up to 12). Read more
Source§

fn find_position<P>(&mut self, pred: P) -> Option<(usize, Self::Item)>
where P: FnMut(&Self::Item) -> bool,

Find the position and value of the first element satisfying a predicate. Read more
Source§

fn find_or_last<P>(self, predicate: P) -> Option<Self::Item>
where Self: Sized, P: FnMut(&Self::Item) -> bool,

Find the value of the first element satisfying a predicate or return the last element, if any. Read more
Source§

fn find_or_first<P>(self, predicate: P) -> Option<Self::Item>
where Self: Sized, P: FnMut(&Self::Item) -> bool,

Find the value of the first element satisfying a predicate or return the first element, if any. Read more
Source§

fn contains<Q>(&mut self, query: &Q) -> bool
where Self: Sized, Self::Item: Borrow<Q>, Q: PartialEq,

Returns true if the given item is present in this iterator. Read more
Source§

fn all_equal(&mut self) -> bool
where Self: Sized, Self::Item: PartialEq,

Check whether all elements compare equal. Read more
Source§

fn all_unique(&mut self) -> bool
where Self: Sized, Self::Item: Eq + Hash,

Check whether all elements are unique (non equal). Read more
Source§

fn dropping(self, n: usize) -> Self
where Self: Sized,

Consume the first n elements from the iterator eagerly, and return the same iterator again. Read more
Source§

fn dropping_back(self, n: usize) -> Self
where Self: Sized + DoubleEndedIterator,

Consume the last n elements from the iterator eagerly, and return the same iterator again. Read more
Source§

fn foreach<F>(self, f: F)
where F: FnMut(Self::Item), Self: Sized,

👎Deprecated since 0.8.0:

Use .for_each() instead

Run the closure f eagerly on each element of the iterator. Read more
Source§

fn concat(self) -> Self::Item
where Self: Sized, Self::Item: Extend<<Self::Item as IntoIterator>::Item> + IntoIterator + Default,

Combine all an iterator’s elements into one element by using Extend. Read more
Source§

fn collect_vec(self) -> Vec<Self::Item>
where Self: Sized,

.collect_vec() is simply a type specialization of Iterator::collect, for convenience.
Source§

fn try_collect<T, U, E>(self) -> Result<U, E>
where Self: Sized + Iterator<Item = Result<T, E>>, Result<U, E>: FromIterator<Result<T, E>>,

.try_collect() is more convenient way of writing .collect::<Result<_, _>>() Read more
Source§

fn set_from<'a, A, J>(&mut self, from: J) -> usize
where A: 'a, Self: Iterator<Item = &'a mut A>, J: IntoIterator<Item = A>,

Assign to each reference in self from the from iterator, stopping at the shortest of the two iterators. Read more
Source§

fn join(&mut self, sep: &str) -> String
where Self::Item: Display,

Combine all iterator elements into one String, separated by sep. Read more
Source§

fn format(self, sep: &str) -> Format<'_, Self>
where Self: Sized,

Format all iterator elements, separated by sep. Read more
Source§

fn format_with<F>(self, sep: &str, format: F) -> FormatWith<'_, Self, F>
where Self: Sized, F: FnMut(Self::Item, &mut dyn FnMut(&dyn Display) -> Result<(), Error>) -> Result<(), Error>,

Format all iterator elements, separated by sep. Read more
Source§

fn fold_results<A, E, B, F>(&mut self, start: B, f: F) -> Result<B, E>
where Self: Iterator<Item = Result<A, E>>, F: FnMut(B, A) -> B,

👎Deprecated since 0.10.0:

Use .fold_ok() instead

Source§

fn fold_ok<A, E, B, F>(&mut self, start: B, f: F) -> Result<B, E>
where Self: Iterator<Item = Result<A, E>>, F: FnMut(B, A) -> B,

Fold Result values from an iterator. Read more
Source§

fn fold_options<A, B, F>(&mut self, start: B, f: F) -> Option<B>
where Self: Iterator<Item = Option<A>>, F: FnMut(B, A) -> B,

Fold Option values from an iterator. Read more
Source§

fn fold1<F>(self, f: F) -> Option<Self::Item>
where F: FnMut(Self::Item, Self::Item) -> Self::Item, Self: Sized,

👎Deprecated since 0.10.2:

Use Iterator::reduce instead

Accumulator of the elements in the iterator. Read more
Source§

fn tree_fold1<F>(self, f: F) -> Option<Self::Item>
where F: FnMut(Self::Item, Self::Item) -> Self::Item, Self: Sized,

Accumulate the elements in the iterator in a tree-like manner. Read more
Source§

fn fold_while<B, F>(&mut self, init: B, f: F) -> FoldWhile<B>
where Self: Sized, F: FnMut(B, Self::Item) -> FoldWhile<B>,

An iterator method that applies a function, producing a single, final value. Read more
Source§

fn sum1<S>(self) -> Option<S>
where Self: Sized, S: Sum<Self::Item>,

Iterate over the entire iterator and add all the elements. Read more
Source§

fn product1<P>(self) -> Option<P>
where Self: Sized, P: Product<Self::Item>,

Iterate over the entire iterator and multiply all the elements. Read more
Source§

fn sorted_unstable(self) -> IntoIter<Self::Item>
where Self: Sized, Self::Item: Ord,

Sort all iterator elements into a new iterator in ascending order. Read more
Source§

fn sorted_unstable_by<F>(self, cmp: F) -> IntoIter<Self::Item>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Sort all iterator elements into a new iterator in ascending order. Read more
Source§

fn sorted_unstable_by_key<K, F>(self, f: F) -> IntoIter<Self::Item>
where Self: Sized, K: Ord, F: FnMut(&Self::Item) -> K,

Sort all iterator elements into a new iterator in ascending order. Read more
Source§

fn sorted(self) -> IntoIter<Self::Item>
where Self: Sized, Self::Item: Ord,

Sort all iterator elements into a new iterator in ascending order. Read more
Source§

fn sorted_by<F>(self, cmp: F) -> IntoIter<Self::Item>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Sort all iterator elements into a new iterator in ascending order. Read more
Source§

fn sorted_by_key<K, F>(self, f: F) -> IntoIter<Self::Item>
where Self: Sized, K: Ord, F: FnMut(&Self::Item) -> K,

Sort all iterator elements into a new iterator in ascending order. Read more
Source§

fn sorted_by_cached_key<K, F>(self, f: F) -> IntoIter<Self::Item>
where Self: Sized, K: Ord, F: FnMut(&Self::Item) -> K,

Sort all iterator elements into a new iterator in ascending order. The key function is called exactly once per key. Read more
Source§

fn k_smallest(self, k: usize) -> IntoIter<Self::Item>
where Self: Sized, Self::Item: Ord,

Sort the k smallest elements into a new iterator, in ascending order. Read more
Source§

fn partition_map<A, B, F, L, R>(self, predicate: F) -> (A, B)
where Self: Sized, F: FnMut(Self::Item) -> Either<L, R>, A: Default + Extend<L>, B: Default + Extend<R>,

Collect all iterator elements into one of two partitions. Unlike Iterator::partition, each partition may have a distinct type. Read more
Source§

fn partition_result<A, B, T, E>(self) -> (A, B)
where Self: Sized + Iterator<Item = Result<T, E>>, A: Default + Extend<T>, B: Default + Extend<E>,

Partition a sequence of Results into one list of all the Ok elements and another list of all the Err elements. Read more
Source§

fn into_group_map<K, V>(self) -> HashMap<K, Vec<V>>
where Self: Sized + Iterator<Item = (K, V)>, K: Hash + Eq,

Return a HashMap of keys mapped to Vecs of values. Keys and values are taken from (Key, Value) tuple pairs yielded by the input iterator. Read more
Source§

fn into_group_map_by<K, V, F>(self, f: F) -> HashMap<K, Vec<V>>
where Self: Sized + Iterator<Item = V>, K: Hash + Eq, F: Fn(&V) -> K,

Return an Iterator on a HashMap. Keys mapped to Vecs of values. The key is specified in the closure. Read more
Source§

fn into_grouping_map<K, V>(self) -> GroupingMap<Self>
where Self: Sized + Iterator<Item = (K, V)>, K: Hash + Eq,

Constructs a GroupingMap to be used later with one of the efficient group-and-fold operations it allows to perform. Read more
Source§

fn into_grouping_map_by<K, V, F>( self, key_mapper: F, ) -> GroupingMap<MapForGrouping<Self, F>>
where Self: Sized + Iterator<Item = V>, K: Hash + Eq, F: FnMut(&V) -> K,

Constructs a GroupingMap to be used later with one of the efficient group-and-fold operations it allows to perform. Read more
Source§

fn min_set(self) -> Vec<Self::Item>
where Self: Sized, Self::Item: Ord,

Return all minimum elements of an iterator. Read more
Source§

fn min_set_by<F>(self, compare: F) -> Vec<Self::Item>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Return all minimum elements of an iterator, as determined by the specified function. Read more
Source§

fn min_set_by_key<K, F>(self, key: F) -> Vec<Self::Item>
where Self: Sized, K: Ord, F: FnMut(&Self::Item) -> K,

Return all minimum elements of an iterator, as determined by the specified function. Read more
Source§

fn max_set(self) -> Vec<Self::Item>
where Self: Sized, Self::Item: Ord,

Return all maximum elements of an iterator. Read more
Source§

fn max_set_by<F>(self, compare: F) -> Vec<Self::Item>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Return all maximum elements of an iterator, as determined by the specified function. Read more
Source§

fn max_set_by_key<K, F>(self, key: F) -> Vec<Self::Item>
where Self: Sized, K: Ord, F: FnMut(&Self::Item) -> K,

Return all minimum elements of an iterator, as determined by the specified function. Read more
Source§

fn minmax(self) -> MinMaxResult<Self::Item>
where Self: Sized, Self::Item: PartialOrd,

Return the minimum and maximum elements in the iterator. Read more
Source§

fn minmax_by_key<K, F>(self, key: F) -> MinMaxResult<Self::Item>
where Self: Sized, K: PartialOrd, F: FnMut(&Self::Item) -> K,

Return the minimum and maximum element of an iterator, as determined by the specified function. Read more
Source§

fn minmax_by<F>(self, compare: F) -> MinMaxResult<Self::Item>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Return the minimum and maximum element of an iterator, as determined by the specified comparison function. Read more
Source§

fn position_max(self) -> Option<usize>
where Self: Sized, Self::Item: Ord,

Return the position of the maximum element in the iterator. Read more
Source§

fn position_max_by_key<K, F>(self, key: F) -> Option<usize>
where Self: Sized, K: Ord, F: FnMut(&Self::Item) -> K,

Return the position of the maximum element in the iterator, as determined by the specified function. Read more
Source§

fn position_max_by<F>(self, compare: F) -> Option<usize>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Return the position of the maximum element in the iterator, as determined by the specified comparison function. Read more
Source§

fn position_min(self) -> Option<usize>
where Self: Sized, Self::Item: Ord,

Return the position of the minimum element in the iterator. Read more
Source§

fn position_min_by_key<K, F>(self, key: F) -> Option<usize>
where Self: Sized, K: Ord, F: FnMut(&Self::Item) -> K,

Return the position of the minimum element in the iterator, as determined by the specified function. Read more
Source§

fn position_min_by<F>(self, compare: F) -> Option<usize>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Return the position of the minimum element in the iterator, as determined by the specified comparison function. Read more
Source§

fn position_minmax(self) -> MinMaxResult<usize>
where Self: Sized, Self::Item: PartialOrd,

Return the positions of the minimum and maximum elements in the iterator. Read more
Source§

fn position_minmax_by_key<K, F>(self, key: F) -> MinMaxResult<usize>
where Self: Sized, K: PartialOrd, F: FnMut(&Self::Item) -> K,

Return the postions of the minimum and maximum elements of an iterator, as determined by the specified function. Read more
Source§

fn position_minmax_by<F>(self, compare: F) -> MinMaxResult<usize>
where Self: Sized, F: FnMut(&Self::Item, &Self::Item) -> Ordering,

Return the postions of the minimum and maximum elements of an iterator, as determined by the specified comparison function. Read more
Source§

fn exactly_one(self) -> Result<Self::Item, ExactlyOneError<Self>>
where Self: Sized,

If the iterator yields exactly one element, that element will be returned, otherwise an error will be returned containing an iterator that has the same output as the input iterator. Read more
Source§

fn at_most_one(self) -> Result<Option<Self::Item>, ExactlyOneError<Self>>
where Self: Sized,

If the iterator yields no elements, Ok(None) will be returned. If the iterator yields exactly one element, that element will be returned, otherwise an error will be returned containing an iterator that has the same output as the input iterator. Read more
Source§

fn multipeek(self) -> MultiPeek<Self>
where Self: Sized,

An iterator adaptor that allows the user to peek at multiple .next() values without advancing the base iterator. Read more
Source§

fn counts(self) -> HashMap<Self::Item, usize>
where Self: Sized, Self::Item: Eq + Hash,

Collect the items in this iterator and return a HashMap which contains each item that appears in the iterator and the number of times it appears. Read more
Source§

fn counts_by<K, F>(self, f: F) -> HashMap<K, usize>
where Self: Sized, K: Eq + Hash, F: FnMut(Self::Item) -> K,

Collect the items in this iterator and return a HashMap which contains each item that appears in the iterator and the number of times it appears, determining identity using a keying function. Read more
Source§

fn multiunzip<FromI>(self) -> FromI
where Self: Sized + MultiUnzip<FromI>,

Converts an iterator of tuples into a tuple of containers. Read more
§

impl<T> Pointable for T

§

const ALIGN: usize

The alignment of pointer.
§

type Init = T

The type for initializers.
§

unsafe fn init(init: <T as Pointable>::Init) -> usize

Initializes a with the given initializer. Read more
§

unsafe fn deref<'a>(ptr: usize) -> &'a T

Dereferences the given pointer. Read more
§

unsafe fn deref_mut<'a>(ptr: usize) -> &'a mut T

Mutably dereferences the given pointer. Read more
§

unsafe fn drop(ptr: usize)

Drops the object pointed to by the given pointer. Read more
Source§

impl<I> SymCurveIterator for I
where I: Iterator<Item = f64>,

Source§

fn sym_curve_iter(self, win: usize, step: usize) -> SymCurveIter<Self> ⓘ

Wraps the iterator in a SymCurveIter. Read more
Source§

impl<T, U> TryFrom<U> for T
where U: Into<T>,

Source§

type Error = Infallible

The type returned in the event of a conversion error.
Source§

fn try_from(value: U) -> Result<T, <T as TryFrom<U>>::Error>

Performs the conversion.
Source§

impl<T, U> TryInto<U> for T
where U: TryFrom<T>,

Source§

type Error = <U as TryFrom<T>>::Error

The type returned in the event of a conversion error.
Source§

fn try_into(self) -> Result<U, <U as TryFrom<T>>::Error>

Performs the conversion.